Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBUE411-GGB
(Plasmid #198233)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 198233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBUE411
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 23361
  • Vector type
    Plant Expression, CRISPR ; plant binary vector
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GRF4-GIF1 chimera cassette
  • Species
    Synthetic; Wheat; Agrobacterium tumefaciens
  • Insert Size (bp)
    4234
  • Promoter Ubiquitin

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgtcaaacactgatagtttCTGCAGGCGCGCTAATTCC
  • 3′ sequencing primer tcgtttcccgccttcagtttGAGCTCGGTACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pPLTP::BBM cassette
  • Species
    Zea mays; Agrobacterium tumefaciens
  • Insert Size (bp)
    3469
  • Promoter maize PLTP

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GGCGCGCCACGCTGCTACTGCTGCTAC
  • 3′ sequencing primer ACTAGTtcggtacccgggGATCTAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GRF4-GIF1 chimera was obtained from the laboratory of Jorge Dubcovsky at the University of California Davis and Howard Hughes Medical Institute (Addgene deposit JD553), and is described in the following publication: Debernardi et al Nat Biotechnol. 2020 Oct 12. doi: 10.1038/s41587-020-0703-0.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBUE411-GGB was a gift from Andrea Gallavotti (Addgene plasmid # 198233 ; http://n2t.net/addgene:198233 ; RRID:Addgene_198233)