Showing: 1 - 20 of 10306 results
-
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_NLuc_FRT-PuroR
Plasmid#177865PurposeCloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertNLuc-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_BSD_FRT-PuroR
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_mGreenLantern_FRT-PuroR-HSV-TK
Plasmid#177868PurposeCloning Backbone for mGreenLantern-based EXSISERS containing FRT-sites flanked PuroR-HSV-TK cassette; clone homology arms via BbsI (or BpiI).DepositorInsertmGreenLantern-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
SITS-ccdb
Plasmid#141067PurposeMultisite gateway destination vector for cell free expression (takes two cassettes). Parton lab clone JBODepositorInsertccdb
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pOT2-poly-cis
Plasmid#141177PurposeTo clone any gene or STTM sequence or artificial miRNA under CaMV 35S promoterDepositorTypeEmpty backboneUseRNAi and Synthetic BiologyTagsExpressionPlantMutationPromoterCaMV 35S promoterAvailabilityAcademic Institutions and Nonprofits only -
pPT-TAR C1
Plasmid#141246PurposeTransformation Associated Recombination (TAR) cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 1DepositorInsertMitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionTagsExpressionBacterial and YeastMutationMinor additional mutations described in manuscriptPromoterAvailabilityAcademic Institutions and Nonprofits only -
pPT-PCR C2
Plasmid#141247PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 2DepositorInsertMitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionTagsExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pPT-PCR C1
Plasmid#141248PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 1DepositorInsertReduced Mitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionTagsExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterNative promoter from pMUT2 relB/relE operon and P…AvailabilityAcademic Institutions and Nonprofits only -
pYCTK001
Plasmid#176705PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter DIG2 of S. cerevisiae (response part)DepositorArticleInsertP-DIG2
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK002
Plasmid#176706PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter FUS1 of S. cerevisiae (response part)DepositorArticleInsertP-FUS1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK003
Plasmid#176707PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter FUS3 (response part).DepositorArticleInsertP-FUS3
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK004
Plasmid#176708PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter MSG5 of S. cerevisiae (response part)DepositorArticleInsertP-MSG5
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK005
Plasmid#176709PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter PRM1 of S. cerevisiae (response part)DepositorArticleInsertP-PRM1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK006
Plasmid#176710PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter SST2 (response part).DepositorArticleInsertP-SST2
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pYCTK007
Plasmid#176711PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor-responsive promoter YPS1 (response part).DepositorArticleInsertP-YPS1
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 1 - 20 of 10306 results